Molecular Basis of Inheritance Test - 14

During replication of double helix DNA, one strands having 3’ to 5’ polarity it is continuous and on other strand it is in small fraction called Okazaki fragments. The polarity of this strand is 5’ to 3’.

The sequences of event are as follows, RNA of retrovirus change into DNA by reverse transcription. Replication of DNA produces more DNA. The DNA produce m-RNA by transcription process and m-RNA translates into specific protein.

Our protein-coding genes have a characteristic sequence of nucleotides, termed the TATA box, in front of the start site of transcription. The typical sequence is something like T-A-T-A-a/t-A-a/t, where a/t refers to positions that can be either A or T.

The TATA-binding protein (sometimes referred to as TBP) recognizes this TATA sequence and binds to it, creating a landmark that marks the start site of transcription

If nitrogenous base sequence of DNA is as ATCTG. The complementary RNA strand should be UAGAC. Thymine of DNA is replaced by uracil (U) in RNA.

The DNA strands are complementary to each other with respect to base sequence.

Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’ .

Therefore, the sequence of nucleotides on DNA polypeptide in direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’

The RNA copy from one section of DNA, which usually corresponds to a single gene, is called messenger RNA (mRNA).

The 2 strands of the DNA molecule are temporarily split by enzymes which cause a short part to be copied into a similarly short section of RNA molecule. The copying is along the same lines as already explained, (A for T, G for C, C for G) except that a different base called U (uracil) replaces T (thymine). So the sequence will be CAU GUU UAU CGC

UAA of mRNA do not code for any amino acids so it is a termination codon. If termination codon is present on mRNA, the protein synthesis stops abruptly at that point.

Synthesis of RNA from DNA is called transcription and it occurs in the nucleus of eukaryotic cells.

DNA replication occurs in the cytoplasm of prokaryotes and in the nucleus of eukaryotes. Regardless of where DNA replication occurs, the basic process is the same.

Synthesis of protein from RNA is called translation and it occurs in the cytoplasm of eukaryotic cells.

messenger RNA (mRNA) is a molecule in cells that carries codes from the DNA in the nucleus to the sites of protein synthesis in the cytoplasma (ribosome) where they can be joined together in specific order to make a specific protein.

In central dogma, transcription is the copying of genetic information present on a DNA to mRNA. This mRNA is used as template to produce protein by the process of translation. Thus, translation is always followed by transcription.

A codon is a sequence of 3 nitrogenous bases located on mRNA that will pair up with the anticodon of tRNA to make the polypeptide (protein) I. 64 codons can be obtained from four nitrogenous bases if arranged in group of 3.