Self Studies

Biology Test 72

Result Self Studies

Biology Test 72
  • Score

    -

    out of -
  • Rank

    -

    out of -
TIME Taken - -
Self Studies
Weekly Quiz Competition
  • Question 1
    4 / -1

    Which of the following is the correct statement?

  • Question 2
    4 / -1

    How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ?

    5' AUGUCCACGAUAGACUGAUAA3'

  • Question 3
    4 / -1

    The thylakoid membrane bears several F0 – F1 particle ATPase/ATP synthase. Which of following is incorrect for these particles?

  • Question 4
    4 / -1

    Super bug is :

  • Question 5
    4 / -1

    A DNA finger printing process involves :-

  • Question 6
    4 / -1

     

    Forelimbs of frog have :

  • Question 7
    4 / -1

    Directions For Questions

    Read the following steps of inspiration.

    A. Increases thoracic volume

    B. Air moves into lungs

    C. Contraction in diaphragm and EICM

    D. Increases pulmonary volume

    E. Lungs expand

    F. Decreases the intra pulmonary pressure (IPP)

    ...view full instructions

     

    Find out the correct sequence of these steps :-

  • Question 8
    4 / -1

    Modern biotechnology consist :-

  • Question 9
    4 / -1

    Which of the following is not a alien species in India?

  • Question 10
    4 / -1

    Ecology explains us :-

Self Studies
User
Question Analysis
  • Correct -

  • Wrong -

  • Skipped -

My Perfomance
  • Score

    -

    out of -
  • Rank

    -

    out of -
Re-Attempt Weekly Quiz Competition
Self Studies Get latest Exam Updates
& Study Material Alerts!
No, Thanks
Self Studies
Click on Allow to receive notifications
Allow Notification
Self Studies
Self Studies Self Studies
To enable notifications follow this 2 steps:
  • First Click on Secure Icon Self Studies
  • Second click on the toggle icon
Allow Notification
Get latest Exam Updates & FREE Study Material Alerts!
Self Studies ×
Open Now